📝 Final Exam Questions (Previous Years)¶

!!! info "Exam Pattern" - Total Marks: 40 - Duration: 2 hours - Pattern: Questions 1, 2, 3 mandatory; Answer 4 OR 5

Final Exam - Spring 2022 (BIO3105_Final_221)¶

Part	Question	Marks	CO
(a)	Name some of the autoimmune diseases. Mention their impact on health.	3	CO1
(b)	Name the types of vaccines used against COVID-19.	2	CO1
(c)	Name some of the noncommunicable diseases. What are the ingredients of food that should be taken into account for those diseases?	3	CO1
(d)	Why do you put DNA sample in the negative terminal of the device for gel electrophoresis?	1	CO1
(e)	Name the goods you would like to protect against biopiracy that is native to Bangladesh (Naming 5 would be sufficient).	1	CO1

Part	Question	Marks	CO
(a)	Do you think you have scope to give your input as a computer engineer in personalized drug design? Give details.	3	CO3
(b)	Suppose you have a restriction enzyme that has a recognition sequence GAA TTC. How you would complete the rDNA for a given sequence of one strand as below show in a pictorial view (You need to complete the DNA with a complementary strand before starting the process). `ATATCGAACTTGCATCTGACGATCGACCGGTCGCCGAATTGCATCG`	4	CO3
(c)	Suppose you have a primer sequence GCA TTA. In PCR you have a fragment of DNA with 25 spaces for bases which will repeat itself after every six sequences. If the above mentioned primer fits on the right hand side of your desired DNA strand (upper), show the whole DNA strand before and show the whole picture after elongation process.	3	CO3

Part	Question	Marks	CO
(a)	For a drought happening in several years back in the north part of the country, explain the resistance and resilience of the ecosystem in a diagram.	4	CO3
(b)	Give a pictorial view of similarities and differences of spleen and thymus.	3	CO3
(c)	With the help of a diagram show the role of insulin to restore homeostatic control in the blood sugar.	3	CO3

Part	Question	Marks	CO
(a)	Discuss if you think we need a change in diet for a 95 kg 130 cm pregnant woman. Give reasons and possible changes you want to recommend in diet. This person has gestational diabetes (diabetes in pregnancy period).	5	CO2
(b)	For the existing ecosystems on earth, explain the basic equations for survival. Do you think chemicals, or sunlight is more significant for the established producer consumer relationships in the existing ecosystem on earth apart for initiation of life? Give reasons behind your answer.	5	CO2

Part	Question	Marks	CO
(a)	Explain the relationship between food and mental stress. Please comment on the steps we should take regarding this matter.	5	CO2
(b)	Discuss the significances of having both positive and negative feedback in our homeostasis control. Give proper reasons behind your answers.	5	CO2

Part	Question	Marks	CO
(a)	Name the enzymes are used for isolation of DNA.	2	CO1
(b)	Differentiate the food web and the food chain.	2	CO1
(c)	GMO stands for what and define it.	2	CO1
(d)	Differentiate autotrophs and heterotrophs.	2	CO1
(e)	Name the components of immune system.	2	CO1

Part	Question	Marks	CO
(a)	Select the ways how homeostasis is maintained when body temperature is below the set point.	4	CO2
(b)	Apply your knowledge why normal BMI value is not used for muscle builders?	3	CO2
(c)	Show how the primers, nucleotide and Taq works for amplification of DNA.	3	CO2

Part	Question	Marks	CO
(a)	People are now consuming more foods high in energy, fats, free sugars and salt/sodium leading to NCD, propose a healthy diet to prevent NCD.	3	CO3
(b)	Integrate the producer and consumer effect in ecosystem.	3	CO3
(c)	Organize your clarification how to separate out different sized DNA fragments, explain.	4	CO3

Part	Question	Marks	CO
(a)	Interpret the equations for chemosynthesis and photosynthesis. Which one of these two do you think vital for ecosystems on earth? Give reasons in brief.	5	CO4
(b)	Explain the relationship between food and mental stress. Please share your thoughts on what actions we should take in this regard.	5	CO4

Part	Question	Marks	CO
(a)	Discuss the relationship of vaccination with primary and secondary response.	5	CO4
(b)	Suppose you have a restriction enzyme that has a recognition sequence GCCG. Demonstrate the rDNA for a given sequence of one strand as below show in a pictorial view (You need to complete the DNA with a complementary strand before starting the process). `ATAACGATAGCCGTATTATGCAATGCATTACGAGCCGTATAAT`	5	CO4

Food Chain	Food Web
Linear pathway	Complex network
Single path of energy	Multiple interconnected paths
One organism at each level	Many organisms at each level

CO	Description
CO1	Describe different biological quantities
CO2	Apply knowledge of biological systems in real-life problems
CO3	Design several biological systems with constraints
CO4	Explain procedures for solving biological systems within constraints